Demo entry 3649456

4.1.pl

   

Submitted by Reinaldo on Feb 16, 2016 at 17:05
Language: Perl. Code size: 280 Bytes.

#!/usr/bin/perl -w 
# Storing DNA in a variable, and printing it out

# First we store the DNA in a variable called $DNA
$DNA = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC';

#NEXT, WE PRINT THE DNA ONTO THE SCREEN
print $DNA;

#Finally, we'll specifically tell the program to exit. 
exit;

This snippet took 0.00 seconds to highlight.

Back to the Entry List or Home.

Delete this entry (admin only).